Homology of Seleno Methyltransferase (smt) Gene from Geobacillus sp. 20k with That from Astragalus bisulcatus

Evi Triana, Imam Supardi, Sunarjati Soedigdoadi, Novik Nurhidayat

Abstract


Methylselenocysteine (MSC) is the most effective form of selenium against cancer. The synthesis of MSC iscatalyzed by seleno methyltransferase (smt) through selenium methylation as its detoxification mechanism. Gene ofsmt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study wasdone on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, November2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence wasanalyzed by the basic local alignment search tool (BLAST). The results showed that smt gene and its homolog weregenerally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its proteintranslation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smtgenes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus,therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken intoconsideration. [MKB. 2010;42(3):128-34].

Key words: Cancer, Geobacillus sp. 20k, non toxic selenium, methyl selenocystein, seleno methyltransferase


References



Refbacks

  • There are currently no refbacks.